Identifiers and Description

Gene Model Identifier

TTHERM_00105330

Standard Name

RPS28 (Ribosomal Protein of the Small subunit 28)

Aliases

PreTt23033 | 7.m00482

Description

RPS28 40S ribosomal protein S28e putative; Homolog of yeast RPS28- human RPS28;

Genome Browser (Macronucleus)



Genome Browser (Micronucleus)

Gene Ontology Annotations

Cellular Component

Molecular Function

Biological Process

Domains

  • ( PF01200 ) ribosomal protein S28e

Gene Expression Profile

Vegetative Cell Cycle (Zhang et al., 2023)

GeneMania

Tetrahymena Stock Center

No Data fetched for Tetrahymena Stock Center

Homologs

Source Identifier Score
Tetrahymena borealis EI9_00370.1 5.998312950603665e-35
Description: ribosomal protein S28e containing protein (69 aa)
Oxytricha Contig12436.0.g46 2.99851380290819e-19
Description: Ribosomal protein S28e
SGD YOR167C 4.0009493637353324e-18
Description: RPS28A Protein component of the small (40S) ribosomal subunit; nearly identical to Rps28Bp and has similarity to rat S28 ribosomal protein
WormBase WBGene00004497 7.9993595954329e-16
Description: locus:rps-28 40S ribosomal protein S28 status:Confirmed UniProt:Q95Y04 protein_id:CCD66705.1
DictyBase DDB_G0285597 0.000000000000020000882446601127
Description: rps28 on chromosome: 4 position 3428530 to 3429424

General Information

No Data fetched for General Information

Associated Literature

  1. Ref:21205638: Rabl J, Leibundgut M, Ataide SF, Haag A, Ban N (2011) Crystal structure of the eukaryotic 40S ribosomal subunit in complex with initiation factor 1. Science (New York, N.Y.) 331(6018):730-6

Sequences

>TTHERM_00105330(coding)
ATGAATACCGAAGAAACTACTAAGGCTAGAATTATGGATGTCCTCGGAAAGACTGGTTCC
AGAGGTGGTATTACCCAAGTTAGAGTCGTATTGATCAGTGGTAAGGAAGAAGGTAGATAA
CTTATTAGAAACGTCAAGGGTGCCTGCAGAGTCGGTGACGTCCTCGAACTTATGGAATGT
GAAAGAGAAGCCAGAAGATTAAGATGA


>TTHERM_00105330(gene)
ATGAATACCGAAGAAACTACTAAGGCTAGAATTATGGATGTCCTCGGAAAGACTGGTAAT
TAATTTAAGATATGAATCACTTCAAATAGTGAACGCGAAAAATTTCCTGAAAAGTTTAGA
TGAAATTTTTGAAAATTAGTTGCCATTTCTCCATTTGAGGAGGGAGCATTATTAATTCAT
AATGCTCAAAATATATATTCATTTGAATACAAATAAAAGCGACTTTAATATGTTCAGTGA
TAGAAAAATGATTGAATTATCATAAAAGGAATAAAAAAATAAAATGGTTTTTTGGGAATT
TTCGCTTATCAACTAGATTTTGTGATGATTTTATTGATGAAATTAAAGAAATGAAAGAAG
GAAATTTTAATAATATTTTTATCTATTTTTATAGGTTCCAGAGGTGGTATTACCCAAGTT
AGAGTCGTATTGATCAGTGGTAAGGAAGAAGGTAGATAACTTATTAGAAACGTCAAGGGT
GCCTGCAGAGTCGGTGACGTCCTCGAACTTATGGAATGTGAAAGAGAAGCCAGAAGATTA
AGATGA


>TTHERM_00105330(protein)
MNTEETTKARIMDVLGKTGSRGGITQVRVVLISGKEEGRQLIRNVKGACRVGDVLELMEC
EREARRLR